EHD2-mCherry
(Plasmid #45933)

• Purpose: caveolar protein, confines caveolae to the plasma membrane
• Depositing Lab: Ari Helenius
• Publication: Stoeber et al EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13.

Backbone

• Vector backbone: pmEGFP-N-DEST
• Backbone manufacturer: Clontech/ custom-made
• Backbone size w/o insert (bp): 4736
• Total vector size (bp): 6365
• Vector type: Mammalian Expression
• Selectable markers: G418

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Eps-15 homology domain-containing protein2
• Alt name: EHD2
• Species: H. sapiens (human)
• Insert Size (bp): 1629
• GenBank ID: NM_014601.3
• Entrez Gene: EHD2 (a.k.a. PAST2)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gttttcccagtcacgacgttgtaaaacgacggccagt
• 3′ sequencing primer: ccctatagtgagtcgtattacatggtcatagctgtttcctgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry