EHD2-T72A-mCherry
(Plasmid
#45935)
-
Purposedominant-negative EHD2 mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmEGFP-N-DEST
-
Backbone manufacturerClontech/ custom-made
- Backbone size w/o insert (bp) 4736
- Total vector size (bp) 6365
-
Vector typeMammalian Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEps-15 homology domain-containing protein2
-
Alt nameEHD2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1629
-
MutationT 72 changed to A (T72A)
-
GenBank IDNM_014601.3
-
Entrez GeneEHD2 (a.k.a. PAST2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gttttcccagtcacgacgttgtaaaacgacggccagt
- 3′ sequencing primer ccctatagtgagtcgtattacatggtcatagctgtttcctgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EHD2-T72A-mCherry was a gift from Ari Helenius (Addgene plasmid # 45935 ; http://n2t.net/addgene:45935 ; RRID:Addgene_45935) -
For your References section:
Oligomers of the ATPase EHD2 confine caveolae to the plasma membrane through association with actin. Stoeber M, Stoeck IK, Hanni C, Bleck CK, Balistreri G, Helenius A. EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13. 10.1038/emboj.2012.98 PubMed 22505029