-
Purposecaveolar protein, confines caveolae to the plasma membrane
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45933-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45933-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmEGFP-N-DEST
-
Backbone manufacturerClontech/ custom-made
- Backbone size w/o insert (bp) 4736
- Total vector size (bp) 6365
-
Vector typeMammalian Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEps-15 homology domain-containing protein2
-
Alt nameEHD2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1629
-
GenBank IDNM_014601.3
-
Entrez GeneEHD2 (a.k.a. PAST2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gttttcccagtcacgacgttgtaaaacgacggccagt
- 3′ sequencing primer ccctatagtgagtcgtattacatggtcatagctgtttcctgg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 45933-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45933-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EHD2-mCherry was a gift from Ari Helenius (Addgene plasmid # 45933 ; http://n2t.net/addgene:45933 ; RRID:Addgene_45933) -
For your References section:
Oligomers of the ATPase EHD2 confine caveolae to the plasma membrane through association with actin. Stoeber M, Stoeck IK, Hanni C, Bleck CK, Balistreri G, Helenius A. EMBO J. 2012 May 16;31(10):2350-64. doi: 10.1038/emboj.2012.98. Epub 2012 Apr 13. 10.1038/emboj.2012.98 PubMed 22505029