pGEX-6p-2-EWSR1
(Plasmid #46384)

• Depositing Lab: Heinz Gehring
• Publication: Pahlich et al Proteins. 2005 Oct 1;61(1):164-75.

Backbone

• Vector backbone: pGEX-6p-2
• Backbone manufacturer: Amersham
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 7500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EWSR1
• Alt name: EWS
• Alt name: EWS RNA-binding protein 1 isoform CRA_e
• Species: H. sapiens (human)
• Insert Size (bp): 2600
• Entrez Gene: EWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: pGEX5'
• 3′ sequencing primer: pGEX3'

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.