Skip to main content

pGL4.10-Claudin-1
(Plasmid #46387)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46387 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 46387-D50 50 μg of DNA in Tris buffer $495
DNA 46387-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL4.10
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4242
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CLDN1 Promoter
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    CLDN1 (a.k.a. CLD1, ILVASC, SEMP1)
  • Promoter CLDN1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
  • 3′ sequencing primer GCTGGGCCCTTCTTAATGTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.10-Claudin-1 was a gift from David Mu (Addgene plasmid # 46387 ; http://n2t.net/addgene:46387 ; RRID:Addgene_46387)
  • For your References section:

    Occludin is a direct target of thyroid transcription factor-1 (TTF-1/NKX2-1). Runkle EA, Rice SJ, Qi J, Masser D, Antonetti DA, Winslow MM, Mu D. J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2. 10.1074/jbc.M112.367987 PubMed 22761434