-
Purpose(Empty Backbone) Backbone contains SHD/C 0.5 Domain TALE N-terminal: TAL C-terminus: LSD1: Isoform 2
-
Depositing Labs
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneunknown
-
Backbone manufacturerJoung Lab
- Backbone size (bp) 8550
-
Modifications to backboneReplaced p65 with LSD1
-
Vector typeMammalian Expression ; TALE LSD1 Expression Vector
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- LSD1 (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATGACGCAGTTCGGGATGAG
- 3′ sequencing primer TTCGGGAATACGGCGATTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EMM65 was a gift from Bradley Bernstein & Eric Mendenhall (Addgene plasmid # 49042 ; http://n2t.net/addgene:49042 ; RRID:Addgene_49042) -
For your References section:
Locus-specific editing of histone modifications at endogenous enhancers. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE. Nat Biotechnol. 2013 Sep 8. doi: 10.1038/nbt.2701. 10.1038/nbt.2701 PubMed 24013198