Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MSCVhygro-F-G9a
(Plasmid #41721)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41721 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVhyg
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 10600
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    G9a
  • Alt name
    EHMT2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3600
  • Tag / Fusion Protein
    • flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

G9A insert contains N665K relative to reference sequence BC018718.1. Depositor states that this mutation should not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVhygro-F-G9a was a gift from Kai Ge (Addgene plasmid # 41721 ; http://n2t.net/addgene:41721 ; RRID:Addgene_41721)
  • For your References section:

    Histone H3K9 methyltransferase G9a represses PPARgamma expression and adipogenesis. Wang L, Xu S, Lee JE, Baldridge A, Grullon S, Peng W, Ge K. EMBO J. 2012 Nov 23. doi: 10.1038/emboj.2012.306. 10.1038/emboj.2012.306 PubMed 23178591