AAV GFP
(Plasmid #49055)

• Purpose: adeno-associated virus (AAV) encoding a green fluorescent protein
• Depositing Lab: Fred Gage
• Publication: Kaspar et al Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12.

Backbone

• Vector backbone: adeno-associated viral (AAVsp)
• Backbone size w/o insert (bp): 6204
• Total vector size (bp): 7074
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Aequorea victoria green
• Insert Size (bp): 720
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: tagccacaccagccaccact
• 3′ sequencing primer: caacgtgctggtctgtgtg

Resource Information

• Supplemental Documents:
  • AAV sp map
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Expression of GFP is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs).