pC1-FGB (FlincG2)
(Plasmid
#49204)
-
PurposeFluorescent reporter for cGMP
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 49204-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 49204-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1 vector
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4044
- Total vector size (bp) 5664
-
Modifications to backboneThe native EGFP was deleted first and then the PCR amplified FlincG2 was cloned at Nhe I and Xho I sites.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlincG2
-
Alt nameFGB
-
Alt nameCR4-C1
-
SpeciesB. taurus (bovine); GFP
-
Insert Size (bp)1620
-
Entrez GenePRKG1 (a.k.a. CGKI, cGK 1, cGKI-beta)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CAACTCCGCCCCATTGACGC
- 3′ sequencing primer None
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byProf. Wolfgang Dostmann at University of Vermont, USA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DNA (Catalog # 49204-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 49204-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-FGB (FlincG2) was a gift from John Garthwaite (Addgene plasmid # 49204 ; http://n2t.net/addgene:49204 ; RRID:Addgene_49204) -
For your References section:
Improved genetically-encoded, FlincG-type fluorescent biosensors for neural cGMP imaging. Bhargava Y, Hampden-Smith K, Chachlaki K, Wood KC, Vernon J, Allerston CK, Batchelor AM, Garthwaite J. Front Mol Neurosci. 2013 Sep 24;6:26. doi: 10.3389/fnmol.2013.00026. 10.3389/fnmol.2013.00026 PubMed 24068983
Map uploaded by the depositor.
Map uploaded by the depositor.
