EGFP-CERT-PH
(Plasmid #49572)

• Purpose: expresses the plekstrin homology domain of CERT/OSBP in mammalian cells
• Depositing Lab: Marci Scidmore
• Publication: Moorhead et al Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15.

Backbone

• Vector backbone: EGFP C2
• Backbone manufacturer: c
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GPBP
• Alt name: CERT
• Species: H. sapiens (human)
• Insert Size (bp): 378
• Mutation: expresses AA 1-122
• GenBank ID: NM_031361.2
• Entrez Gene: COL4A3BP (a.k.a. CERT, CERTL, GPBP, MRD34, STARD11)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI/SalI (destroyed during cloning)
• 5′ sequencing primer: EGFP C (CATGGTCCTGCTGGAGTTCGTG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PH binding domain of GPBP recognizes PI4P