pGFP AH2 tensin
(Plasmid #50514)

• Purpose: This plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.
• Depositing Lab: Kenneth Yamada
• Publication: Pankov et al J Cell Biol. 2000 Mar 6;148(5):1075-90.

Backbone

• Vector backbone: pGZ21dxZ
• Backbone manufacturer: Yamada Lab, Tamura et al., Science 280: 1614-7 (1998)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tensin
• Alt name: TNS1
• Alt name: cytoskeletal protein, domain
• Species: G. gallus (chicken)
• Insert Size (bp): 320
• Mutation: AA659--761, including actin homology 2 domain of tensin
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GFP FW (AAAGACCCCAACGAGAAGCG)
• 3′ sequencing primer: GFP ASO (TTGTAACCATTATAAGCTGC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry