Skip to main content

pCAG-GBP6-10gly-VPminx4
(Plasmid #50796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50796 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCAG-GFP
  • Backbone size w/o insert (bp) 4823
  • Total vector size (bp) 5420
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GBP6-VPminx4 activation domain fusion protein
  • Alt name
    ADG
  • Alt name
    GBP6-10gly-VPminx4
  • Species
    Synthetic
  • Insert Size (bp)
    597
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGACTTCCTTTGTCCCAAATCTG
  • 3′ sequencing primer TAGCCAGAAGTCAGATGCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GBP6 was obtained from Heinrich Leonhardt and Ulrich Rothbauer at Ludwig Maximilian University of Munich

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.

Note that GBP6 was verified in Addgene's quality control sequencing but cannot be displayed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-GBP6-10gly-VPminx4 was a gift from Connie Cepko (Addgene plasmid # 50796 ; http://n2t.net/addgene:50796 ; RRID:Addgene_50796)
  • For your References section:

    A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120