Skip to main content

psicheck2 PTEN 3'UTR
(Plasmid #50936)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50936 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 50936-D50 50 μg of DNA in Tris buffer $495
DNA 50936-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    psiCheck-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTEN 3'UTR
  • Alt name
    phosphatase and tensin homolog
  • Species
    H. sapiens (human)
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, PTENgama, TEP1)
  • Promoter T7
  • Tag / Fusion Protein
    • Renilla luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer psiCHECK2-F, GTCCGCAACTACAACGCCTACCTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers used to amplify the 3'UTR of PTEN:
PTEN3′UTR-F TAGAGGAGCCGTCAAATCCA,
PTEN3′UTR-R CCCCCACTTTAGTGCACAGT,

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psicheck2 PTEN 3'UTR was a gift from Pier Pandolfi (Addgene plasmid # 50936 ; http://n2t.net/addgene:50936 ; RRID:Addgene_50936)
  • For your References section:

    Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Tay Y, Kats L, Salmena L, Weiss D, Tan SM, Ala U, Karreth F, Poliseno L, Provero P, Di Cunto F, Lieberman J, Rigoutsos I, Pandolfi PP. Cell. 2011 Oct 14;147(2):344-57. doi: 10.1016/j.cell.2011.09.029. 10.1016/j.cell.2011.09.029 PubMed 22000013