Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCHECK2-p27Kip1 3'UTR
(Plasmid #29476)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 29476 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    psiCHECK2 (Promega)
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    p27 Kip1 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT
  • 3′ sequencing primer AATGAGAGTGTTTCGTTCCTTCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-p27Kip1 3'UTR was a gift from Judy Lieberman (Addgene plasmid # 29476 ; ; RRID:Addgene_29476)
  • For your References section:

    miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, Chowdhury D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W, Lieberman J. Mol Cell. 2009 Sep 11. 35(5):610-25. 10.1016/j.molcel.2009.08.020 PubMed 19748357