Skip to main content

psiCHECK2-E2F1 3'UTR
(Plasmid #29468)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29468 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 29468-D50 50 μg of DNA in Tris buffer $495
DNA 29468-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    psiCHECK2 (Promega)
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E2F1 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1268
  • Entrez Gene
    E2F1 (a.k.a. E2F-1, RBAP1, RBBP3, RBP3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT
  • 3′ sequencing primer AATGAGAGTGTTTCGTTCCTTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-E2F1 3'UTR was a gift from Judy Lieberman (Addgene plasmid # 29468 ; http://n2t.net/addgene:29468 ; RRID:Addgene_29468)
  • For your References section:

    miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, Chowdhury D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W, Lieberman J. Mol Cell. 2009 Sep 11. 35(5):610-25. 10.1016/j.molcel.2009.08.020 PubMed 19748357