Skip to main content

pBBRBB-Ppuf843-1200-DsRed
(Plasmid #50962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50962 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 50962-D50 50 μg of DNA in Tris buffer $495
DNA 50962-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBBRBB
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 5000
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DsRed
  • Promoter Ppuf843-1200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATCCTGAACTTATCTAGACC
  • 3′ sequencing primer GCAGGTCCTGAAGTTAACTAG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBBRBB-Ppuf843-1200-DsRed was a gift from Claudia Schmidt-dannert (Addgene plasmid # 50962 ; http://n2t.net/addgene:50962 ; RRID:Addgene_50962)
  • For your References section:

    BioBrick compatible vector system for protein expression in Rhodobacter sphaeroides. Tikh IB, Held M, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2014 Feb 9. 10.1007/s00253-014-5527-8 PubMed 24509770