pBBRBB-Ppuf843-1200-DsRed
(Plasmid
#50962)
-
PurposeExpressed DsRed using the Ppuf843-1200 promoter segment, for use in R. sphaeroides
-
Depositing Lab
-
Depositing OrganizationUniversity of Minnesota
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 50962-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 50962-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBBRBB
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 5000
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDsRed
- Promoter Ppuf843-1200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CATCCTGAACTTATCTAGACC
- 3′ sequencing primer GCAGGTCCTGAAGTTAACTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 50962-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 50962-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBBRBB-Ppuf843-1200-DsRed was a gift from Claudia Schmidt-dannert (Addgene plasmid # 50962 ; http://n2t.net/addgene:50962 ; RRID:Addgene_50962) -
For your References section:
BioBrick compatible vector system for protein expression in Rhodobacter sphaeroides. Tikh IB, Held M, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2014 Feb 9. 10.1007/s00253-014-5527-8 PubMed 24509770
Map uploaded by the depositor.
