-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 32549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBBRBB
-
Backbone manufacturerSchmidt-Dannert Lab
- Backbone size w/o insert (bp) 4138
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)719
-
Entrez GeneeGFP (a.k.a. pPRS3a_01)
- Promoter Consitutive lac
-
Tag
/ Fusion Protein
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer pBBinF (CATCCTGAACTTATCTAGACC)
- 3′ sequencing primer pBBinR (GCAGGTCCTGAAGTTAACTAG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBBRBB-eGFP was a gift from Claudia Schmidt-dannert (Addgene plasmid # 32549 ; http://n2t.net/addgene:32549 ; RRID:Addgene_32549) -
For your References section:
Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, Wawrzyn GT, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28. 10.1007/s00253-011-3633-4 PubMed 22033566