Skip to main content

pACBB-eGFP
(Plasmid #32551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32551 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 32551-D50 50 μg of DNA in Tris buffer $495
DNA 32551-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pACBB
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    719
  • Entrez Gene
    eGFP (a.k.a. pPRS3a_01)
  • Promoter Consitutive lac
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer pBBinF (CATCCTGAACTTATCTAGACC)
  • 3′ sequencing primer pBBinR (GCAGGTCCTGAAGTTAACTAG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACBB-eGFP was a gift from Claudia Schmidt-dannert (Addgene plasmid # 32551 ; http://n2t.net/addgene:32551 ; RRID:Addgene_32551)
  • For your References section:

    Optimized compatible set of BioBrick vectors for metabolic pathway engineering. Vick JE, Johnson ET, Choudhary S, Bloch SE, Lopez-Gallego F, Srivastava P, Tikh IB, Wawrzyn GT, Schmidt-Dannert C. Appl Microbiol Biotechnol. 2011 Dec;92(6):1275-86. Epub 2011 Oct 28. 10.1007/s00253-011-3633-4 PubMed 22033566