-
PurposeNowGFP gene for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-30
-
Backbone manufacturerQIAGEN
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4250
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNowGFP
-
Alt nameWasCFP2
-
SpeciesSynthetic
-
Insert Size (bp)750
-
MutationWasCFP with substitutions E6K, L42M, T43S, V68M, I128V, V150A, N164Y, K166T, N170D, I171V, Q177L, T230P, and M233A
-
GenBank IDKX377672 KX377672
- Promoter T5
-
Tag
/ Fusion Protein
- HisTag (with a mutation but still working) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
- 3′ sequencing primer CCGAGCGTTCTGAACAAATC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NowGFP /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 74749 ; http://n2t.net/addgene:74749 ; RRID:Addgene_74749) -
For your References section:
Green fluorescent protein with anionic tryptophan-based chromophore and long fluorescence lifetime. Sarkisyan KS, Goryashchenko AS, Lidsky PV, Gorbachev DA, Bozhanova NG, Gorokhovatsky AY, Pereverzeva AR, Ryumina AP, Zherdeva VV, Savitsky AP, Solntsev KM, Bommarius AS, Sharonov GV, Lindquist JR, Drobizhev M, Hughes TE, Rebane A, Lukyanov KA, Mishin AS. Biophys J. 2015 Jul 21;109(2):380-9. doi: 10.1016/j.bpj.2015.06.018. 10.1016/j.bpj.2015.06.018 PubMed 26200874