Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

WasCFP /pQE-30
(Plasmid #79858)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79858 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-30
  • Backbone manufacturer
    QIAGEN
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4250
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    WasCFP
  • Alt name
    WasCFP
  • Species
    Synthetic
  • Insert Size (bp)
    750
  • Mutation
    Cyan fluorescent protein mCerulean with substitutions V61K, D148G, Y151N and L207Q.
  • GenBank ID
    KX377671 KX377671
  • Promoter T5 promoter / lac operator
  • Tag / Fusion Protein
    • HisTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
  • 3′ sequencing primer CCGAGCGTTCTGAACAAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WasCFP /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 79858 ; http://n2t.net/addgene:79858 ; RRID:Addgene_79858)
  • For your References section:

    Tryptophan-based chromophore in fluorescent proteins can be anionic. Sarkisyan KS, Yampolsky IV, Solntsev KM, Lukyanov SA, Lukyanov KA, Mishin AS. Sci Rep. 2012;2:608. doi: 10.1038/srep00608. Epub 2012 Aug 29. 10.1038/srep00608 PubMed 22934131