Skip to main content

pSKB1-GW-hsp68-Venus
(Plasmid #51291)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51291 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSKB1
  • Backbone manufacturer
    Sarah Bronson
  • Backbone size w/o insert (bp) 14405
  • Total vector size (bp) 17497
  • Vector type
    Mouse Targeting

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gateway Cloning Site+Venus YFP
  • Species
    Synthetic
  • Insert Size (bp)
    3092
  • Promoter Hsp68

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site MluI (destroyed during cloning)
  • 5′ sequencing primer CCCAGCCTTTGATCATGTTT
  • 3′ sequencing primer CTGGGCAACAGAGAAATATCCTGTCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sarah Bronson provided the pSKB1 backbone plasmid, and Atsushi Miyawaki provided the Venus-YFP gene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is included in the following paper(s):

Wilkinson, A. C. et al. Single site-specific integration targeting coupled with embryonic stem cell differentiation provides a high-throughput alternative to in vivo enhancer analyses. Biology Open 2, 1229–1238 (2013).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSKB1-GW-hsp68-Venus was a gift from Len Pennacchio (Addgene plasmid # 51291)
  • For your References section:

    Function-based identification of mammalian enhancers using site-specific integration. Dickel DE, Zhu Y, Nord AS, Wylie JN, Akiyama JA, Afzal V, Plajzer-Frick I, Kirkpatrick A, Gottgens B, Bruneau BG, Visel A, Pennacchio LA. Nat Methods. 2014 Mar 23. doi: 10.1038/nmeth.2886. 10.1038/nmeth.2886 PubMed 24658141