pSKB1-GW-hsp68-Venus
(Plasmid
#51291)
-
PurposeUsed for integrating an enhancer and YFP reporter gene into the mouse Hprt locus. Plasmid has no insulator.
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSKB1
-
Backbone manufacturerSarah Bronson
- Backbone size w/o insert (bp) 14405
- Total vector size (bp) 17497
-
Vector typeMouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGateway Cloning Site+Venus YFP
-
SpeciesSynthetic
-
Insert Size (bp)3092
- Promoter Hsp68
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site MluI (destroyed during cloning)
- 5′ sequencing primer CCCAGCCTTTGATCATGTTT
- 3′ sequencing primer CTGGGCAACAGAGAAATATCCTGTCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySarah Bronson provided the pSKB1 backbone plasmid, and Atsushi Miyawaki provided the Venus-YFP gene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is included in the following paper(s):
Wilkinson, A. C. et al. Single site-specific integration targeting coupled with embryonic stem cell differentiation provides a high-throughput alternative to in vivo enhancer analyses. Biology Open 2, 1229–1238 (2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKB1-GW-hsp68-Venus was a gift from Len Pennacchio (Addgene plasmid # 51291) -
For your References section:
Function-based identification of mammalian enhancers using site-specific integration. Dickel DE, Zhu Y, Nord AS, Wylie JN, Akiyama JA, Afzal V, Plajzer-Frick I, Kirkpatrick A, Gottgens B, Bruneau BG, Visel A, Pennacchio LA. Nat Methods. 2014 Mar 23. doi: 10.1038/nmeth.2886. 10.1038/nmeth.2886 PubMed 24658141