pSKB1-GW-hsp68-Venus-H19
(Plasmid #51292)

• Purpose: Used for integrating an enhancer and YFP reporter gene into the mouse Hprt locus. Plasmid has an H19 insulator before the Hprt promoter.
• Depositing Lab: Len Pennacchio
• Depositing Organization: Lawrence Berkeley National Laboratory
  Located in United States of America
• Publication: Dickel et al Nat Methods. 2014 Mar 23. doi: 10.1038/nmeth.2886.

Backbone

• Vector backbone: pSKB1
• Backbone manufacturer: Sarah Bronson
• Backbone size w/o insert (bp): 14376
• Total vector size (bp): 19564
• Vector type: Mouse Targeting

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Gateway Cloning Site+Venus YFP+H19 Insulator
• Species: Synthetic
• Insert Size (bp): 5188
• Promoter: Hsp68

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCCAGCCTTTGATCATGTTT
• 3′ sequencing primer: CTGGGCAACAGAGAAATATCCTGTCTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Sarah Bronson provided the pSKB1 plasmid, and Atsushi Miyawaki provided the Venus-YFP gene.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry