pGL3-PUb
(Plasmid
#52891)
-
PurposeAedes aegypti polyubiquitin promoter driving firefly luciferase
-
Depositing Lab
-
Depositing OrganizationVirginia Polytechnic Institute and State University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 52891-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 52891-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4747
- Total vector size (bp) 6142
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepolyubiquitin promoter
-
Alt namePUb
-
SpeciesAedes aegypti
-
Insert Size (bp)1395
- Promoter Ae aegypti polyubiquitin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer ataggctgtccccagtgcaagt
- 3′ sequencing primer gtttcatagcttctgccaaccgaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 52891-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 52891-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-PUb was a gift from Zach Adelman (Addgene plasmid # 52891 ; http://n2t.net/addgene:52891 ; RRID:Addgene_52891) -
For your References section:
Validation of novel promoter sequences derived from two endogenous ubiquitin genes in transgenic Aedes aegypti. Anderson MA, Gross TL, Myles KM, Adelman ZN. Insect Mol Biol. 2010 Aug;19(4):441-9. doi: 10.1111/j.1365-2583.2010.01005.x. Epub 2010 Apr 26. 10.1111/j.1365-2583.2010.01005.x PubMed 20456509