-
Purpose(Empty Backbone) Aedes aegypti polyubiquitin promoter followed by MCS
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLfa
- Backbone size (bp) 3506
-
Vector typeInsect Expression
- Promoter Ae aegptyi polyubiquitin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ATTACTcAAGCGTTTCCTCGT
- 3′ sequencing primer CTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLfa-PUb-MCS was a gift from Zach Adelman (Addgene plasmid # 52908 ; http://n2t.net/addgene:52908 ; RRID:Addgene_52908)