Skip to main content
Addgene
Open Menu

CMV-Y-GECO1
(Plasmid #55766)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55766 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 55766-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 55766-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 3203
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Y-GECO1.0
  • Alt name
    A yellow fluorescent calcium ion indicator with inverted fluorescent response
  • Species
    Synthetic
  • Insert Size (bp)
    1368
  • GenBank ID
    KJ193859
  • Promoter CMV
  • Tag / Fusion Protein
    • 6x His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Could not make stable cell line using this vector.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-Y-GECO1 was a gift from Robert Campbell (Addgene plasmid # 55766 ; http://n2t.net/addgene:55766 ; RRID:Addgene_55766)

  • For your References section:

    Microfluidic cell sorter-aided directed evolution of a protein-based calcium ion indicator with an inverted fluorescent response. Zhao Y, Abdelfattah AS, Zhao Y, Ruangkittisakul A, Ballanyi K, Campbell RE, Harrison DJ. Integr Biol (Camb). 2014 May 19. 10.1039/c4ib00039k PubMed 24840546
Related items:
Commonly requested with: