-
PurposeReprogram somatic cells to iPS cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Utah
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 58525-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 58525-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCEP4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameneo
-
Insert Size (bp)816
Gene/Insert 2
-
Gene/Insert nametk
-
Insert Size (bp)1131
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameoct4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1317
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
Gene/Insert 4
-
Gene/Insert nameKlf4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)971
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
Gene/Insert 5
-
Gene/Insert nameSox2
-
Insert Size (bp)1610
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
Gene/Insert 6
-
Gene/Insert namemyc
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter EF1a
Cloning Information for Gene/Insert 6
- Cloning method Unknown
- 5′ sequencing primer CGAttaatTAAtcgtgaggctccggtgcccgtcagt
- (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameEBNA-1
-
Insert Size (bp)1923
Gene/Insert 8
-
Gene/Insert nameAmp
-
Insert Size (bp)858
Gene/Insert 9
-
Gene/Insert nameLin28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2647
-
Entrez GeneLIN28A (a.k.a. CSDD1, LIN-28, LIN28, ZCCHC1, lin-28A)
Gene/Insert 10
-
Gene/Insert nameNanog
-
SpeciesH. sapiens (human)
-
Insert Size (bp)935
-
Entrez GeneNANOG
- Promoter CAG
Cloning Information for Gene/Insert 10
- Cloning method Unknown
- 5′ sequencing primer TAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAA
- (Common Sequencing Primers)
Gene/Insert 11
-
Gene/Insert nameIRES
-
Insert Size (bp)581
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 58525-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 58525-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMaster1 was a gift from Mario Capecchi (Addgene plasmid # 58525 ; http://n2t.net/addgene:58525 ; RRID:Addgene_58525) -
For your References section:
Efficient germ-line transmission obtained with transgene-free induced pluripotent stem cells. Wu S, Wu Y, Zhang X, Capecchi MR. Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):10678-83. doi: 10.1073/pnas.1409933111. Epub 2014 Jul 7. 10.1073/pnas.1409933111 PubMed 25002522