pFB-U6_CreOff-CMV-EGFP-shCtrl1
(Plasmid
#58669)
-
PurposeExpresses Cre regulated (Cre off) control1 shRNA and fluorescent reporter eGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFB-CMV-SV40
- Total vector size (bp) 7512
-
Vector typeMammalian Expression, RNAi, Cre/Lox
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameControl1 shRNA
-
gRNA/shRNA sequenceGgaggatcaaattgatagtaaaccGTTTTGGCCACTGACTGACggtttactatcaatttgatcctcTTTTTG
- Promoter U6
-
Tag
/ Fusion Protein
- CMV-EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pLLU-5 cacagacttgtgggagaagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene was unable to sequence verify the entire shRNA sequence due to the hairpin structure of the shRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-U6_CreOff-CMV-EGFP-shCtrl1 was a gift from Savio Chan (Addgene plasmid # 58669)