pFB-U6_CreOff-CMV-tdTomato-shCtrl1
(Plasmid
#58671)
-
PurposeExpresses Cre regulated (Cre off) control1 shRNA and fluorescent reporter tdtomato
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFB-floxed_U6-CreOff-CMV-tdTomato-WRE-bGHpA (Addgene plasmid 58668)
-
Backbone manufacturerSavio Chan Lab
- Total vector size (bp) 8169
-
Vector typeMammalian Expression, RNAi, Cre/Lox
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameControl1 shRNA
-
gRNA/shRNA sequenceGgaggatcaaattgatagtaaaccGTTTTGGCCACTGACTGACggtttactatcaatttgatcctcTTTTTG
- Promoter U6
-
Tag
/ Fusion Protein
- CMV-tdTomato (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer pLLU-5 cacagacttgtgggagaagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB-U6_CreOff-CMV-tdTomato-shCtrl1 was a gift from Savio Chan (Addgene plasmid # 58671)