-
PurposeExpress wild-type form of Ran-mRFP1 in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 59750-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 59750-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1-polyA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRan-mRFP1
-
SpeciesM. musculus (mouse)
- Promoter CMV and T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTGCTTACTGGCTTATCG
- 3′ sequencing primer CCAAACTTTTATTTGTGCACAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 59750-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 59750-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-RanWT-mRFP1-polyA was a gift from Yi Zhang (Addgene plasmid # 59750 ; http://n2t.net/addgene:59750 ; RRID:Addgene_59750) -
For your References section:
Nucleosome assembly is required for nuclear pore complex assembly in mouse zygotes. Inoue A, Zhang Y. Nat Struct Mol Biol. 2014 Jul;21(7):609-16. doi: 10.1038/nsmb.2839. Epub 2014 Jun 8. 10.1038/nsmb.2839 PubMed 24908396