Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTK21
(Plasmid #37396)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37396 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ran
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    651
  • Mutation
    T24N
  • Entrez Gene
    RAN (a.k.a. ARA24, Gsp1, TC4)
  • Tags / Fusion Proteins
    • mCherry (N terminal on insert)
    • TEV (N terminal on insert)
    • S-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing result exactly matches the full plasmid sequence provided by the depositing laboratory; however, when these sequences are compared to GenBank ID NP_006316.1 there appears to be a T24N mutation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK21 was a gift from Iain Cheeseman (Addgene plasmid # 37396 ; http://n2t.net/addgene:37396 ; RRID:Addgene_37396)
  • For your References section:

    Chromosome- and spindle-pole-derived signals generate an intrinsic code for spindle position and orientation. Kiyomitsu T, Cheeseman IM. Nat Cell Biol. 2012 Feb 12;14(3):311-7. doi: 10.1038/ncb2440. 10.1038/ncb2440 PubMed 22327364