RFN_EGFP_81
(Plasmid
#60073)
-
PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease
-
Depositing Lab
-
Depositing OrganizationMassachusetts General Hospital
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 60073-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 60073-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSQT1313
-
Backbone manufacturerJoung lab (Addgene plasmid # 53370)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepair of multiplex gRNAs targeting EGFP
-
Alt nameEGFP gRNA pair #81
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer OS280 (5’-CAGGGTTATTGTCTCATGAGCGG-3’)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Left gRNA target site: CCGGCAAGCTGCCCGTGCCC
Right gRNA target site: CAGGGTCAGCTTGCCGTAGG
DNA (Catalog # 60073-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 60073-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RFN_EGFP_81 was a gift from Keith Joung (Addgene plasmid # 60073 ; http://n2t.net/addgene:60073 ; RRID:Addgene_60073) -
For your References section:
Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Tsai SQ, Wyvekens N, Khayter C, Foden JA, Thapar V, Reyon D, Goodwin MJ, Aryee MJ, Joung JK. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. 10.1038/nbt.2908 PubMed 24770325