pENTR D-TOPO-C3_33
(Plasmid
#60275)
-
PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.
-
Depositing Lab
-
Depositing OrganizationImperial College London
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepENTR/D-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2580
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGLIS3 enhancer
-
Alt nameGLIS3
-
SpeciesH. sapiens (human)
-
Entrez GeneGLIS3 (a.k.a. NDH, ZNF515)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Fw
- 3′ sequencing primer M13 Rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
chromosome : chr9; start: 4279544 end: 4281151 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGACAGGATTCCATCGGAAGA Rv primer used for cloning: CCAACGTTAGGCCTTGGGAGTGC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR D-TOPO-C3_33 was a gift from Jorge Ferrer (Addgene plasmid # 60275 ; http://n2t.net/addgene:60275 ; RRID:Addgene_60275) -
For your References section:
Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Pasquali L, Gaulton KJ, Rodriguez-Segui SA, Mularoni L, Miguel-Escalada I, Akerman I, Tena JJ, Moran I, Gomez-Marin C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, Garcia-Hurtado J, Maestro MA, Pattou F, Piemonti L, Berney T, Gloyn AL, Ravassard P, Gomez-Skarmeta JL, Muller F, McCarthy MI, Ferrer J. Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12. 10.1038/ng.2870 PubMed 24413736