-
Purposefor generation of a eGFP specific sgRNA from a T7 promoter
-
Depositing Lab
-
Depositing OrganizationInstitut Curie
Located in France -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61051-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61051-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneDR274
-
Backbone manufacturerJoung Lab, Addgene plasmid # 42250
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP sgRNA
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
eGFP sgRNA = GGCGAGGGCGATGCCACCTA
DNA (Catalog # 61051-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61051-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DR274-eGFP sgRNA was a gift from Filippo Del Bene (Addgene plasmid # 61051 ; http://n2t.net/addgene:61051 ; RRID:Addgene_61051) -
For your References section:
Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Auer TO, Duroure K, De Cian A, Concordet JP, Del Bene F. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. 10.1101/gr.161638.113 PubMed 24179142
