Skip to main content

CMV-mito-LAR-GECO1.2
(Plasmid #61245)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61245 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 61245-D50 50 μg of DNA in Tris buffer $495
DNA 61245-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1 (-)
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6854
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LAR-GECO1.2
  • Alt name
    low affinity red intensiometric genetically encoded Ca2+-indicators for optical version 1.2
  • Species
    Synthetic
  • Insert Size (bp)
    1254
  • Mutation
    Substitutions relative to R-GECO1.2: N45I/A47R/E138V/K324E
  • GenBank ID
    KP091741
  • Promoter CMV
  • Tag / Fusion Protein
    • a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The construct is numbered based on GCaMP.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-mito-LAR-GECO1.2 was a gift from Robert Campbell (Addgene plasmid # 61245 ; http://n2t.net/addgene:61245 ; RRID:Addgene_61245)
  • For your References section:

    Red fluorescent genetically encoded Ca2+ indicators for use in mitochondria and endoplasmic reticulum. Wu J, Prole DL, Shen Y, Lin Z, Gnanasekaran A, Liu Y, Chen L, Zhou H, Chen SR, Usachev YM, Taylor CW, Campbell RE. Biochem J. 2014 Nov 15;464(1):13-22. doi: 10.1042/BJ20140931. 10.1042/BJ20140931 PubMed 25164254