-
PurposeMammalian expression of mitochondria-targeting blue-green emission ratiometric genetically encoded Ca2+ indicator for optical imaging
-
Depositing Lab
-
Publication
-
Sequence Information
-
Depositor Sequences: Partial (1)
-
Addgene Sequences: Full (1) Partial (3)
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 32461 | Plasmid sent as bacteria in agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1 (-)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5600
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGEM-GECO
-
Alt nameemission ratiometric genetically encoded Ca2+-indicators for optical imaging
-
Insert Size (bp)1248
-
MutationGCaMP3 L60P/K69E/N77Y/D86G/N98I/K119I/L173Q/T223S/N302S/R377P/K380Q/S 404G/E430V
-
GenBank IDJN258409
- Promoter CMV
-
Tag
/ Fusion Protein
- a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Articles Citing this Plasmid
Depositor Comments
The vector of the CMV-mito-GEM-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:
(http://www.pnas.org/content/106/37/15651.abstract).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mito-GEM-GECO1 was a gift from Robert Campbell (Addgene plasmid # 32461) -
For your References section:
An Expanded Palette of Genetically Encoded Ca2+ Indicators. Zhao Y, Araki S, Wu J, Teramoto T, Chang YF, Nakano M, Abdelfattah AS, Fujiwara M, Ishihara T, Nagai T, Campbell RE. Science. 2011 Sep 8. 10.1126/science.1208592 PubMed 21903779