-
PurposeExpresses PLZF in mammalian cells
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneTetO-FUW
- Backbone size w/o insert (bp) 8376
- Total vector size (bp) 10410
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLZF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2034
-
MutationI380T and G580D
-
Entrez GeneZBTB16 (a.k.a. PLZF, ZNF145)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAGACCACCGCACAGCAAGC
- 3′ sequencing primer TTCCGCCGTGGCAATAGGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene Comment: Please note that Addgene identified a I380T and G580D mutation in PLZF compared to NCBI reference Sequence ID: NP_001018011.1.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-PLZF was a gift from Rudolf Jaenisch (Addgene plasmid # 61543 ; http://n2t.net/addgene:61543 ; RRID:Addgene_61543) -
For your References section:
Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632