pINTO-NSA::hSNRNP70
(Plasmid
#61726)
-
PurposeExpression of human SNRNP70 fused to monomeric streptavidin (N-terminus)
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61726-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61726-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepINTO-N-SA
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNRP70
-
SpeciesH. sapiens (human)
-
MutationTwo silent mutations to ensure restriction site compatibility
-
GenBank IDNM_003089.5
-
Entrez GeneSNRNP70 (a.k.a. RNPU1Z, RPU1, SNRP70, Snp1, U1-70K, U170K, U1AP, U1RNP)
- Promoter T-REx (CMV + 2xTetO2)
-
Tag
/ Fusion Protein
- mSA (monomeric streptavidin) (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTC GTT TAG TGA ACC GTC AG
- 3′ sequencing primer AGATGGCTGGCAACTAGAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61726-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61726-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINTO-NSA::hSNRNP70 was a gift from Roberto Bonasio (Addgene plasmid # 61726 ; http://n2t.net/addgene:61726 ; RRID:Addgene_61726) -
For your References section:
In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790