pINTO-NFH::hSNRNP70
(Plasmid #65926)

• Purpose: Expression of human SNRNP70 fused to Flag-HA tag (N-terminus)
• Depositing Lab: Roberto Bonasio
• Publication: Beck et al J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29.

Backbone

• Vector backbone: pINTO-NFH
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 6743
• Total vector size (bp): 8060
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL10 Gold
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: small nuclear ribonucleoprotein 70kDa (U1)
• Species: H. sapiens (human)
• Mutation: Two silent mutations
• GenBank ID: NM_003089.5
• Entrez Gene: SNRNP70 (a.k.a. RNPU1Z, RPU1, SNRP70, Snp1, U1-70K, U170K, U1AP, U1RNP)
• Promoter: CMV/TO
• Tag / Fusion Protein:
  • FLAG-HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHi (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CTC GTT TAG TGA ACC GTC AG
• 3′ sequencing primer: AGATGGCTGGCAACTAGAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry