-
PurposeExpression of human SNRNP70 fused to Flag-HA tag (N-terminus)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepINTO-NFH
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 6743
- Total vector size (bp) 8060
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesmall nuclear ribonucleoprotein 70kDa (U1)
-
SpeciesH. sapiens (human)
-
MutationTwo silent mutations
-
GenBank IDNM_003089.5
-
Entrez GeneSNRNP70 (a.k.a. RNPU1Z, RPU1, SNRP70, Snp1, U1-70K, U170K, U1AP, U1RNP)
- Promoter CMV/TO
-
Tag
/ Fusion Protein
- FLAG-HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTC GTT TAG TGA ACC GTC AG
- 3′ sequencing primer AGATGGCTGGCAACTAGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pINTO-NFH::hSNRNP70 was a gift from Roberto Bonasio (Addgene plasmid # 65926 ; http://n2t.net/addgene:65926 ; RRID:Addgene_65926) -
For your References section:
In Vivo Proximity Labeling for the Detection of Protein-Protein and Protein-RNA Interactions. Beck DB, Narendra V, Drury WJ 3rd, Casey R, Jansen PW, Yuan ZF, Garcia BA, Vermeulen M, Bonasio R. J Proteome Res. 2014 Dec 5;13(12):6135-43. doi: 10.1021/pr500196b. Epub 2014 Oct 29. 10.1021/pr500196b PubMed 25311790