-
PurposeLTR7-driving reporter
-
Depositing Lab
-
Depositing OrganizationMax-Delbrueck-Centrum fuer Molekulare Medizin (MDC)
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 62541-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 62541-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepT2/BH
- Backbone size w/o insert (bp) 3373
- Total vector size (bp) 5644
-
Vector typeMammalian Expression ; Sleeping Beauty transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLTR7-GFP
-
Insert Size (bp)2000
- Promoter LTR7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCGTGAATTCATGCTGCGAGATGGGAAACA
- 3′ sequencing primer AATCGCTAGCGGGTGAAGGAGAAGGGGTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 62541-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 62541-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2/LTR7-GFP was a gift from Zsuzsanna Izsvak (Addgene plasmid # 62541 ; http://n2t.net/addgene:62541 ; RRID:Addgene_62541) -
For your References section:
Primate-specific endogenous retrovirus-driven transcription defines naive-like stem cells. Wang J, Xie G, Singh M, Ghanbarian AT, Rasko T, Szvetnik A, Cai H, Besser D, Prigione A, Fuchs NV, Schumann GG, Chen W, Lorincz MC, Ivics Z, Hurst LD, Izsvak Z. Nature. 2014 Dec 18;516(7531):405-9. doi: 10.1038/nature13804. Epub 2014 Oct 15. 10.1038/nature13804 PubMed 25317556