Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LentiCRISPR_Hs_MBD3_ex2
(Plasmid #62623)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62623 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR
  • Backbone manufacturer
    Zhang lab
  • Backbone size w/o insert (bp) 13450
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MBD3 gRNA
  • gRNA/shRNA sequence
    CTTGCCCGTGCGGAAGTCGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    MBD3
  • Promoter EFS

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hU6-F (for gRNA)
  • 3′ sequencing primer hSpCas9-R1 5'-CGCTCGTGCTTCTTATCCTC (for Cas9)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPR_Hs_MBD3_ex2 was a gift from Paul Wade (Addgene plasmid # 62623 ; http://n2t.net/addgene:62623 ; RRID:Addgene_62623)