Skip to main content

pU6a:sgRNA(tyr)
(Plasmid #64250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64250 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 64250-D50 50 μg of DNA in Tris buffer $495
DNA 64250-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pLR-NN
  • Backbone manufacturer
    Adam Bogdanove, Daniel Voytas lab
  • Backbone size w/o insert (bp) 2568
  • Total vector size (bp) 2986
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6a:sgRNA (tyr)
  • gRNA/shRNA sequence
    gGACTGGAGGACTTCTGGGG
  • Species
    D. rerio (zebrafish)
  • GenBank ID
    NC_007126.6 NC_007126.6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer TTGGGCCCGGTCTCTAGTCAAGTCTCTCAGCGTTTCTCC
  • 3′ sequencing primer CTCGGTGCCACTTTTTCAAGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6a:sgRNA(tyr) was a gift from Wenbiao Chen (Addgene plasmid # 64250 ; http://n2t.net/addgene:64250 ; RRID:Addgene_64250)
  • For your References section:

    Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Yin L, Maddison LA, Li M, Kara N, LaFave MC, Varshney GK, Burgess SM, Patton JG, Chen W. Genetics. 2015 Apr 8. pii: genetics.115.176917. 10.1534/genetics.115.176917 PubMed 25855067