-
PurposePlasmid encoding multiple cloning site, rybozyme and IRES-CAS9.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64668 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 2988
- Total vector size (bp) 8235
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCAS9
-
SpeciesSynthetic
-
Insert Size (bp)4188
-
Tags
/ Fusion Proteins
- Internal ribosome entry site (N terminal on backbone)
- Flag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GAAGCCGCTTGGAATAAGGC
- 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHDV ribozyme
-
SpeciesHepatitis delta virus
-
Insert Size (bp)68
-
Tag
/ Fusion Protein
- guide RNA scahold sequence (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GCACATTTCCCCGAAAAGTG
- 3′ sequencing primer GGCTTCGGCCAGTAACGTTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCS-rybozyme-IRES-CAS9 was a gift from Wataru Fujii (Addgene plasmid # 64668 ; http://n2t.net/addgene:64668 ; RRID:Addgene_64668) -
For your References section:
Development of a mono-promoter-driven CRISPR/Cas9 system in mammalian cells. Yoshioka S, Fujii W, Ogawa T, Sugiura K, Naito K. Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341. 10.1038/srep18341 PubMed 26669567