pCNL-C1_fibrillarin
(Plasmid
#65709)
-
PurposeExpresses CNL-fibrillarin in mammalian cells
-
Depositing Lab
-
Depositing OrganizationRIKEN Quantitative Biology Center (QBiC)
Located in Japan -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 65709-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 65709-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCNL-C1
-
Backbone manufacturerAddgene #64307
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6600
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefibrillarin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
-
Entrez GeneFBL (a.k.a. FIB, FLRN, Nop1, RNU3IP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- CNL (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GAGTTCGTGAAGGTGAAGGGCC
- 3′ sequencing primer EBV Reverse
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypmTurquoise2-N1 (gifted from Dr Dorus Gadella Lab), Phamret-Fibrillarin/pcDNA3 (Addgene #51954)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 65709-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 65709-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCNL-C1_fibrillarin was a gift from Yasushi Okada (Addgene plasmid # 65709 ; http://n2t.net/addgene:65709 ; RRID:Addgene_65709) -
For your References section:
Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507