Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #101910)


Item Catalog # Description Quantity Price (USD)
Plasmid 101910 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5711
  • Total vector size (bp) 6999
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    Thermomicrobium roseum
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7+LacO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ttcccctctagaaataattttgtttaactttaagaag
  • 3′ sequencing primer gcagccggatccCTAACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_BGL1 was a gift from Steve Shih (Addgene plasmid # 101910 ; ; RRID:Addgene_101910)
  • For your References section:

    An Automated Induction Microfluidics System for Synthetic Biology. Husser MC, Vo PQN, Sinha H, Ahmadi F, Shih SCC. ACS Synth Biol. 2018 Mar 16;7(3):933-944. doi: 10.1021/acssynbio.8b00025. Epub 2018 Mar 8. 10.1021/acssynbio.8b00025 PubMed 29516725