Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET_BGL3
(Plasmid #101912)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101912 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET16b
  • Backbone size w/o insert (bp) 5711
  • Total vector size (bp) 8160
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    β-glucosidase
  • Alt name
    bgl
  • Species
    Rhodothermus marinus DSM4252
  • Insert Size (bp)
    2520
  • GenBank ID
    WP_012844561.1
  • Promoter T7+LacO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer cttcttaaagttaaacaaaattatttctagaggggaa
  • 3′ sequencing primer gcagccggatccCTACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_BGL3 was a gift from Steve Shih (Addgene plasmid # 101912 ; http://n2t.net/addgene:101912 ; RRID:Addgene_101912)
  • For your References section:

    An Automated Induction Microfluidics System for Synthetic Biology. Husser MC, Vo PQN, Sinha H, Ahmadi F, Shih SCC. ACS Synth Biol. 2018 Mar 16;7(3):933-944. doi: 10.1021/acssynbio.8b00025. Epub 2018 Mar 8. 10.1021/acssynbio.8b00025 PubMed 29516725