pTrEno
(Plasmid #115474)

• Purpose: Eno-promoter driven expression vector for protein production in Trichoderma reesei
• Depositing Lab: Steve Decker
• Publication: Linger et al Biotechnol Biofuels. 2015 Mar 18;8:45. doi: 10.1186/s13068-015-0230-2. eCollection 2015.

Backbone

• Vector backbone: pTR50
• Vector type: Unspecified
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cel7A
• Alt name: CBH1
• Alt name: Cellobiohydrolase 1
• Species: Trichoderma reesei
• Insert Size (bp): 1545
• Mutation: Introns have been removed
• GenBank ID: XP_006969224.1
• Promoter: Trichoderma reesei Enolase (Eno) promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Pac1 (not destroyed)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: ATCGCCCAGCTACCTACCTC
• 3′ sequencing primer: GACCTGCGACAGACAACCAA

Resource Information

• Supplemental Documents:
  • pTreno.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This Trichoderma reesei expression vector currently expresses native T. reesei Cel7A (CBH1), but this can readily be exchanged for other coding sequences. Prior to integration into T. reesei genome, use SbfI and XhoI to linearize the vector.