Skip to main content

pCX-Klf4
(Plasmid #66656)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66656 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 66656-D50 50 μg of DNA in Tris buffer $495
DNA 66656-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCX
  • Total vector size (bp) 6216
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Klf4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1423
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tttgtcccaaatctgtgcgg
  • 3′ sequencing primer gctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Klf4 came from plasmid pCX-OKS-2A (Addgene plasmid #19771).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The backbone of the plasmid is pCX-OKS-2A (Addgene plasmid #19771).

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCX-Klf4 was a gift from Barak Cohen (Addgene plasmid # 66656 ; http://n2t.net/addgene:66656 ; RRID:Addgene_66656)
  • For your References section:

    Interactions between pluripotency factors specify cis-regulation in embryonic stem cells. Fiore C, Cohen BA. Genome Res. 2016 Jun;26(6):778-86. doi: 10.1101/gr.200733.115. Epub 2016 Apr 15. 10.1101/gr.200733.115 PubMed 27197208