Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCX-Klf5
(Plasmid #66657)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66657 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCX
  • Total vector size (bp) 6134
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Klf5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1341
  • Entrez Gene
    Klf5 (a.k.a. 4930520J07Rik, Bteb2, CKLF, IKLF)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tttgtcccaaatctgtgcgg
  • 3′ sequencing primer gctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Klf5 came from plasmid pMXs-ms-Klf5 (Addgene plasmid #50787).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The backbone of the plasmid is pCX-OKS-2A (Addgene plasmid #19771).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCX-Klf5 was a gift from Barak Cohen (Addgene plasmid # 66657 ; http://n2t.net/addgene:66657 ; RRID:Addgene_66657)
  • For your References section:

    Interactions between pluripotency factors specify cis-regulation in embryonic stem cells. Fiore C, Cohen BA. Genome Res. 2016 Jun;26(6):778-86. doi: 10.1101/gr.200733.115. Epub 2016 Apr 15. 10.1101/gr.200733.115 PubMed 27197208