pCX-Klf4
(Plasmid
#66656)
-
PurposeFor expression of mouse Klf4.
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 66656-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 66656-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCX
- Total vector size (bp) 6216
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKlf4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1423
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tttgtcccaaatctgtgcgg
- 3′ sequencing primer gctcaaggggcttcatgatg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKlf4 came from plasmid pCX-OKS-2A (Addgene plasmid #19771).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone of the plasmid is pCX-OKS-2A (Addgene plasmid #19771).
DNA (Catalog # 66656-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 66656-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCX-Klf4 was a gift from Barak Cohen (Addgene plasmid # 66656 ; http://n2t.net/addgene:66656 ; RRID:Addgene_66656) -
For your References section:
Interactions between pluripotency factors specify cis-regulation in embryonic stem cells. Fiore C, Cohen BA. Genome Res. 2016 Jun;26(6):778-86. doi: 10.1101/gr.200733.115. Epub 2016 Apr 15. 10.1101/gr.200733.115 PubMed 27197208