pdx1-mTQ2-P2A-FlpO-PA
(Plasmid #67279)

• Purpose: Pancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon context
• Depositing Lab: Jannik Elverløv-Jakobsen
• Publication: Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR (unpublished)

Backbone

• Vector backbone: amp
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 13000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mTQ2=mturquoise2 blue fluorescent gene
• Species: blue fluorescent gene
• Insert Size (bp): 800
• Promoter: pdx
• Tag / Fusion Protein:
  • linked to FlpO through an P2A ribosomal skipping site (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (unknown if destroyed)
• 3′ cloning site: BsrGI (unknown if destroyed)
• 5′ sequencing primer: CACCATGGACCCTCATGATA
• 3′ sequencing primer: aactccagcaggaccatgt

Gene/Insert 2

• Gene/Insert name: FlpO recombinase
• Insert Size (bp): 1300
• Promoter: pdx
• Tag / Fusion Protein:
  • mTQ2 blue fluorescent (N terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: gatcacatggtcctgctg
• 3′ sequencing primer: atcagcaaggagatgatcgc

Resource Information

• Supplemental Documents:
  • Pdx1 promoter_Mtq2_FlpO
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry